Jatropha Genome Database

JcCB0036391.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0036391.20 - phase: 2 /TE/partial
         (2293 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c02042                                                             52   6e-06

>KJC_c02042 
          Length = 866

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1097 ctggacgtgaataatgcatttttacatggt 1126
            ||||||||||||||||||||||| ||||||
Sbjct: 562  ctggacgtgaataatgcatttttgcatggt 591