Jatropha Genome Database
- JcCB0019451.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0019451.10 + phase: 0
(567 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c08664 72 2e-12
KJC_c07732 56 9e-08
>KJC_c08664
Length = 689
Score = 71.9 bits (36), Expect = 2e-12
Identities = 136/168 (80%), Gaps = 1/168 (0%)
Strand = Plus / Minus
Query: 373 tgtgacattgctataaattgggctggtggattgcatcatg-ctaagaaatgtgaggcatc 431
|||||||||||||| |||||||||||||| | ||||||| ||||||| || || || ||
Sbjct: 616 tgtgacattgctatcaattgggctggtggccttcatcatgactaagaagtgcgaagcttc 557
Query: 432 tggattttgttacatcaatgacttagtattgggaattttggagcttcttaaatatcatgc 491
||| ||||| || |||||||| | || | | ||| |||||||||||||| ||||
Sbjct: 556 tggcttttgctatgtcaatgacattgttctcgcaatcttggagcttcttaagacgcatga 497
Query: 492 ccgtgttctatatatcgatatagacgtgcatcatggtgatggtgtgga 539
|||||||| ||| ||||||||||| | || |||||||| ||||||||
Sbjct: 496 gcgtgttctctatgtcgatatagacattcaccatggtgacggtgtgga 449
>KJC_c07732
Length = 468
Score = 56.0 bits (28), Expect = 9e-08
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 379 attgctataaattgggctggtggattgcatcatgctaaga 418
|||||| | |||||||||||||| ||||||||||||||||
Sbjct: 160 attgctttgaattgggctggtggtttgcatcatgctaaga 121