Jatropha Genome Database

JcCB0008031.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0008031.30 - phase: 0 
         (942 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c05502                                                             50   1e-05

>KJC_c05502 
          Length = 928

 Score = 50.1 bits (25), Expect = 1e-05
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 734 tggtggaagcacaaggagagcaattggatgatattga 770
           |||||||||| ||||| |||||||| |||||||||||
Sbjct: 209 tggtggaagctcaaggtgagcaattagatgatattga 173