Jatropha Genome Database

JcCA0317001.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0317001.10 + phase: 0 /partial
         (267 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c02389                                                            339   2e-93
KJC_c01447                                                             86   5e-17
KJC_c10941                                                             58   1e-08
KJC_c00035                                                             58   1e-08

>KJC_c02389 
          Length = 733

 Score =  339 bits (171), Expect = 2e-93
 Identities = 174/175 (99%)
 Strand = Plus / Minus

                                                                       
Query: 4   gttcaggttttggctccgttgcctattggatttactgtgttcgtagtgcatatggccacc 63
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 175 gttccggttttggctccgttgcctattggatttactgtgttcgtagtgcatatggccacc 116

                                                                       
Query: 64  ctccccataactggcactgggatcaatcctgctagaagttttggagctgctgtcatttat 123
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 115 ctccccataactggcactgggatcaatcctgctagaagttttggagctgctgtcatttat 56

                                                                  
Query: 124 aacaagaagatggtttgggatgatcattggattttctgggtcggaccacttgttg 178
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 55  aacaagaagatggtttgggatgatcattggattttctgggtcggaccacttgttg 1


>KJC_c01447 
          Length = 907

 Score = 85.7 bits (43), Expect = 5e-17
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 73  actggcactgggatcaatcctgctagaagttttggagctgctgtcatttataacaagaag 132
           ||||||||||| ||||| |||||||| ||||||||||||||||| || || |||||  | 
Sbjct: 314 actggcactggcatcaaccctgctaggagttttggagctgctgttatctacaacaaagac 255

                                                          
Query: 133 atggtttgggatgatcattggattttctgggtcggaccacttgttgg 179
           | ||  ||||||||||| |||||||||||||| |||||  |||||||
Sbjct: 254 aaggcatgggatgatcagtggattttctgggttggaccttttgttgg 208


>KJC_c10941 
          Length = 854

 Score = 58.0 bits (29), Expect = 1e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 139 tgggatgatcattggattttctgggtcggaccacttgttgg 179
           |||||||||||||||||||||||||| |||||  |||||||
Sbjct: 699 tgggatgatcattggattttctgggttggaccgtttgttgg 739


>KJC_c00035 
          Length = 958

 Score = 58.0 bits (29), Expect = 1e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 139 tgggatgatcattggattttctgggtcggaccacttgttgg 179
           |||||||||||||||||||||||||| |||||  |||||||
Sbjct: 792 tgggatgatcattggattttctgggttggaccgtttgttgg 832



 Score = 52.0 bits (26), Expect = 7e-07
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 215 tgagagcaggagctgttaaagctttgggatcattccgcggcaaccc 260
           ||||||||| |||| | |||||||||||||| |||||| |||||||
Sbjct: 868 tgagagcagcagctatcaaagctttgggatctttccgcagcaaccc 913