Jatropha Genome Database
- JcCA0317001.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0317001.10 + phase: 0 /partial
(267 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c02389 339 2e-93
KJC_c01447 86 5e-17
KJC_c10941 58 1e-08
KJC_c00035 58 1e-08
>KJC_c02389
Length = 733
Score = 339 bits (171), Expect = 2e-93
Identities = 174/175 (99%)
Strand = Plus / Minus
Query: 4 gttcaggttttggctccgttgcctattggatttactgtgttcgtagtgcatatggccacc 63
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 175 gttccggttttggctccgttgcctattggatttactgtgttcgtagtgcatatggccacc 116
Query: 64 ctccccataactggcactgggatcaatcctgctagaagttttggagctgctgtcatttat 123
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 115 ctccccataactggcactgggatcaatcctgctagaagttttggagctgctgtcatttat 56
Query: 124 aacaagaagatggtttgggatgatcattggattttctgggtcggaccacttgttg 178
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 55 aacaagaagatggtttgggatgatcattggattttctgggtcggaccacttgttg 1
>KJC_c01447
Length = 907
Score = 85.7 bits (43), Expect = 5e-17
Identities = 91/107 (85%)
Strand = Plus / Minus
Query: 73 actggcactgggatcaatcctgctagaagttttggagctgctgtcatttataacaagaag 132
||||||||||| ||||| |||||||| ||||||||||||||||| || || ||||| |
Sbjct: 314 actggcactggcatcaaccctgctaggagttttggagctgctgttatctacaacaaagac 255
Query: 133 atggtttgggatgatcattggattttctgggtcggaccacttgttgg 179
| || ||||||||||| |||||||||||||| ||||| |||||||
Sbjct: 254 aaggcatgggatgatcagtggattttctgggttggaccttttgttgg 208
>KJC_c10941
Length = 854
Score = 58.0 bits (29), Expect = 1e-08
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 139 tgggatgatcattggattttctgggtcggaccacttgttgg 179
|||||||||||||||||||||||||| ||||| |||||||
Sbjct: 699 tgggatgatcattggattttctgggttggaccgtttgttgg 739
>KJC_c00035
Length = 958
Score = 58.0 bits (29), Expect = 1e-08
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 139 tgggatgatcattggattttctgggtcggaccacttgttgg 179
|||||||||||||||||||||||||| ||||| |||||||
Sbjct: 792 tgggatgatcattggattttctgggttggaccgtttgttgg 832
Score = 52.0 bits (26), Expect = 7e-07
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 215 tgagagcaggagctgttaaagctttgggatcattccgcggcaaccc 260
||||||||| |||| | |||||||||||||| |||||| |||||||
Sbjct: 868 tgagagcagcagctatcaaagctttgggatctttccgcagcaaccc 913