Jatropha Genome Database
- JcCA0313731.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0313731.10 - phase: 0 /pseudo
(1993 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c04137 88 1e-16
KJC_c03459 66 4e-10
>KJC_c04137
Length = 497
Score = 87.7 bits (44), Expect = 1e-16
Identities = 89/104 (85%)
Strand = Plus / Plus
Query: 301 caagaaaatactatgattcaaacttgtgcagtagcatgttatagtatatcagttggaggt 360
||||||||||| || ||||| |||||||| || || |||||||| || | |||||||||
Sbjct: 286 caagaaaatacaataattcagacttgtgctgttgcttgttatagcattgctgttggaggt 345
Query: 361 gggtttgcttcttatcttttgggattaaacaggaagacatatga 404
|| |||| |||||||| |||||||||||||||||||||||||
Sbjct: 346 ggttttgggtcttatctactgggattaaacaggaagacatatga 389
>KJC_c03459
Length = 494
Score = 65.9 bits (33), Expect = 4e-10
Identities = 75/89 (84%)
Strand = Plus / Plus
Query: 1549 ttctacaaggcatttgatgttggaaatccaaagggagagtttaaagctccttatgcatta 1608
|||||||| || |||||||| || || || | ||||||| ||||||||| ||||| |
Sbjct: 197 ttctacaaagcttttgatgtggggaaccccgatggagagtataaagctccctatgctatc 256
Query: 1609 atatacagaaacatggcaattcttggtgt 1637
|| ||||||||||||||||||||||||||
Sbjct: 257 atctacagaaacatggcaattcttggtgt 285