Jatropha Genome Database

JcCA0311301.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0311301.30 - phase: 0 
         (522 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c11417                                                             92   2e-18

>KJC_c11417 
          Length = 637

 Score = 91.7 bits (46), Expect = 2e-18
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 109 attgttaatgttgcttcaaaatgtggaatgaccaactctaattacacagagctcaatcag 168
           |||||||||||||||||| |||||||  ||||||| || || ||||| || || | ||||
Sbjct: 389 attgttaatgttgcttcacaatgtggcttgaccaattccaactacactgaactgactcag 330

                                                                       
Query: 169 ttatatgagaagtacaaagacaaaggtcttgagatactggcatttccatgcaatcaattt 228
           |||||  |||||||||| ||  ||||| | ||||| ||||| ||||||||||||||||||
Sbjct: 329 ttataccagaagtacaaggatcaaggtttggagattctggcttttccatgcaatcaattt 270

             
Query: 229 gg 230
           ||
Sbjct: 269 gg 268