Jatropha Genome Database

JcCA0308351.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0308351.10 + phase: 1 /partial
         (1325 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c11595                                                             64   9e-10
KJC_c06681                                                             54   9e-07

>KJC_c11595 
          Length = 438

 Score = 63.9 bits (32), Expect = 9e-10
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 770 aaatattctgcttgatgggaattacaatgcaaaaatatcagattttggcttg 821
           ||||||||| || |||| |||||||||||||||  |||||||||||||||||
Sbjct: 78  aaatattctcctggatgagaattacaatgcaaaggtatcagattttggcttg 129


>KJC_c06681 
          Length = 1485

 Score = 54.0 bits (27), Expect = 9e-07
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 342  acaagaaattttagatcagattctgttttgggtgaaggtggttttgg 388
            |||| |||||| ||| |||||| | ||||||||||||||||||||||
Sbjct: 1231 acaaaaaatttcagagcagattgtcttttgggtgaaggtggttttgg 1185