Jatropha Genome Database
- JcCA0308351.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0308351.10 + phase: 1 /partial
(1325 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c11595 64 9e-10
KJC_c06681 54 9e-07
>KJC_c11595
Length = 438
Score = 63.9 bits (32), Expect = 9e-10
Identities = 47/52 (90%)
Strand = Plus / Plus
Query: 770 aaatattctgcttgatgggaattacaatgcaaaaatatcagattttggcttg 821
||||||||| || |||| ||||||||||||||| |||||||||||||||||
Sbjct: 78 aaatattctcctggatgagaattacaatgcaaaggtatcagattttggcttg 129
>KJC_c06681
Length = 1485
Score = 54.0 bits (27), Expect = 9e-07
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 342 acaagaaattttagatcagattctgttttgggtgaaggtggttttgg 388
|||| |||||| ||| |||||| | ||||||||||||||||||||||
Sbjct: 1231 acaaaaaatttcagagcagattgtcttttgggtgaaggtggttttgg 1185