Jatropha Genome Database

JcCA0308071.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0308071.20 - phase: 0 
         (1167 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c06414                                                             52   3e-06

>KJC_c06414 
          Length = 433

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 110/138 (79%)
 Strand = Plus / Plus

                                                                        
Query: 924  catgcccccaacgctaatagttgtggcagaacatgactttatgagagaccgggctgttgt 983
            |||||| ||||| || | ||| ||||| ||||||||||  ||||||||||| ||  ||| 
Sbjct: 86   catgcctccaacactgacagtggtggctgaacatgactggatgagagaccgagccattgc 145

                                                                        
Query: 984  ttactcggaggaactgcgtaaagttaatgtggatgctccccttcttgattataaggatgc 1043
            |||||| || || ||| | || || ||||| ||||| ||  |||| || |||||||||||
Sbjct: 146  ttactctgaagagctgaggaaggtgaatgtcgatgcacctgttctcgagtataaggatgc 205

                              
Query: 1044 agtgcacgagtttgcaac 1061
            ||| || || ||||||||
Sbjct: 206  agttcatgaatttgcaac 223