Jatropha Genome Database

JcCA0307901.30
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0307901.30 - phase: 2 /partial
         (826 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c08962                                                             68   4e-11
KJC_c03357                                                             58   4e-08
KJC_c08106                                                             52   2e-06

>KJC_c08962 
          Length = 505

 Score = 67.9 bits (34), Expect = 4e-11
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 284 tataatgcaaagctttcagattttggactagcaacagatggtccacaagg 333
           |||||||||||||||||||||||||| ||||||| || |||||| |||||
Sbjct: 124 tataatgcaaagctttcagattttggtctagcaaaagctggtccgcaagg 75


>KJC_c03357 
          Length = 588

 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 287 aatgcaaagctttcagattttggactagcaacagatggtcc 327
           ||||| ||||||||||||||||| ||||||| |||||||||
Sbjct: 364 aatgcgaagctttcagattttggcctagcaagagatggtcc 324


>KJC_c08106 
          Length = 831

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 287 aatgcaaagctttcagattttggactagcaacagatgg 324
           ||||||||||||||||||||||| || |||| ||||||
Sbjct: 224 aatgcaaagctttcagattttgggcttgcaaaagatgg 261