Jatropha Genome Database
- JcCA0299701.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0299701.10 - phase: 2 /pseudo/partial
(1692 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c03802 88 8e-17
KJC_c02548 52 5e-06
>KJC_c03802
Length = 851
Score = 87.7 bits (44), Expect = 8e-17
Identities = 120/144 (83%), Gaps = 1/144 (0%)
Strand = Plus / Minus
Query: 856 tcaattctagcagttgattaccctgtggagaaaatagcttgctacgtttctgatgatgga 915
||||||||||| | |||||||||||| || ||| | ||||| || |||||||||||||||
Sbjct: 302 tcaattctagctgctgattaccctgttgaaaaacttgcttgttatgtttctgatgatgga 243
Query: 916 ggtgctctacttacgtttgaggcaatggctgaggcttgcaagctttgctgatttatgggt 975
||||| || || || |||||||| ||||| || || |||||| |||||| || | |||||
Sbjct: 242 ggtgcacttctaacatttgaggccatggcagaagc-tgcaagttttgctaatatttgggt 184
Query: 976 tccattttgtcgaaaacatgatat 999
||| || || || |||||||||||
Sbjct: 183 tcctttctgccgtaaacatgatat 160
>KJC_c02548
Length = 628
Score = 52.0 bits (26), Expect = 5e-06
Identities = 50/58 (86%)
Strand = Plus / Minus
Query: 177 tgattacatgaattatacagtgcatattcctcctacgccggataatcaaccaatggat 234
||||| |||||| ||||| |||||||| || ||||| || ||||||||||| ||||||
Sbjct: 318 tgatttcatgaactatacggtgcatataccacctacccctgataatcaacctatggat 261