Jatropha Genome Database

JcCA0296911.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0296911.10 - phase: 0 /partial
         (890 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c09623                                                            105   2e-22

>KJC_c09623 
          Length = 979

 Score =  105 bits (53), Expect = 2e-22
 Identities = 53/53 (100%)
 Strand = Plus / Minus

                                                                
Query: 835 gttgctgggtctttacctaaggctttagctaggcgtggacatcgagttatggt 887
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 647 gttgctgggtctttacctaaggctttagctaggcgtggacatcgagttatggt 595