Jatropha Genome Database
- JcCA0286981.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0286981.10 + phase: 0 /partial
(529 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c06943 86 1e-16
>KJC_c06943
Length = 939
Score = 85.7 bits (43), Expect = 1e-16
Identities = 94/111 (84%)
Strand = Plus / Minus
Query: 226 tttcctgatggccgtgacgggcgaactttcactcttaaggctgaaacatcggaagattta 285
||||||||||| ||||| |||||| | ||||| || |||||||| || || ||||||||
Sbjct: 574 tttcctgatggacgtgatgggcgagcattcaccctcaaggctgagacgtccgaagatttg 515
Query: 286 tatgagtggaagactgcgctcgaaaatgctctggcacaagcaccaagtgct 336
|||||||||||||| || || ||| |||| || || |||||||||||||||
Sbjct: 514 tatgagtggaagacagccctagaacatgcccttgcgcaagcaccaagtgct 464