Jatropha Genome Database

JcCA0286981.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0286981.10 + phase: 0 /partial
         (529 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c06943                                                             86   1e-16

>KJC_c06943 
          Length = 939

 Score = 85.7 bits (43), Expect = 1e-16
 Identities = 94/111 (84%)
 Strand = Plus / Minus

                                                                       
Query: 226 tttcctgatggccgtgacgggcgaactttcactcttaaggctgaaacatcggaagattta 285
           ||||||||||| ||||| |||||| | ||||| || |||||||| || || |||||||| 
Sbjct: 574 tttcctgatggacgtgatgggcgagcattcaccctcaaggctgagacgtccgaagatttg 515

                                                              
Query: 286 tatgagtggaagactgcgctcgaaaatgctctggcacaagcaccaagtgct 336
           |||||||||||||| || || ||| |||| || || |||||||||||||||
Sbjct: 514 tatgagtggaagacagccctagaacatgcccttgcgcaagcaccaagtgct 464