Jatropha Genome Database
- JcCA0282511.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0282511.10 + phase: 0
(1818 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c02146 64 1e-09
>KJC_c02146
Length = 1821
Score = 63.9 bits (32), Expect = 1e-09
Identities = 65/76 (85%)
Strand = Plus / Minus
Query: 1515 gatcggaacggtcaaaggaatcaacggtggagctgtgaccaaatcagtatcttgtcatca 1574
||||||| || ||||||||||||||||||| || ||||| |||||||||||||| ||
Sbjct: 433 gatcggatcgatcaaaggaatcaacggtgggaaagttaccaagtcagtatcttgtcacca 374
Query: 1575 aagcctgtatccttac 1590
|||| |||| ||||||
Sbjct: 373 aagcttgtacccttac 358
Score = 61.9 bits (31), Expect = 5e-09
Identities = 40/43 (93%)
Strand = Plus / Minus
Query: 1762 attgaggtttgccattggatatttgagaatgatatgacttgga 1804
|||||||| ||||| |||||||||||||||||| |||||||||
Sbjct: 187 attgaggtgtgccactggatatttgagaatgatttgacttgga 145