Jatropha Genome Database
- JcCA0240711.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0240711.10 - phase: 0 /partial
(378 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c00385 165 9e-41
>KJC_c00385
Length = 1284
Score = 165 bits (83), Expect = 9e-41
Identities = 284/351 (80%)
Strand = Plus / Minus
Query: 28 gtcactggcgctgctgggcaaataggctatgctattgttccaatgattgctagaggagtc 87
|||||||| ||||| || ||||| || ||||| |||| || ||||||||||| ||||||
Sbjct: 1174 gtcactggggctgcaggacaaattggatatgcgcttgtccccatgattgctaggggagtc 1115
Query: 88 atgctaggccctgatcaacctgtaattctgcacatgcttgatattgaacctgcagctgag 147
||||| || |||| |||||||| || || ||| |||||||||| ||||||||| |||
Sbjct: 1114 atgcttggtactgaccaacctgtcatcctccacttgcttgatatcccacctgcagcagag 1055
Query: 148 gccttgaacggggtgaaaatggaaatgatagatgcagcctttcctctgctaaaaggagtt 207
|| ||||| || ||||| ||||| || | |||||||| |||||||| || ||||| |||
Sbjct: 1054 gcattgaatggtgtgaagatggagttggttgatgcagcttttcctcttcttaaaggtgtt 995
Query: 208 attgctactactgatgttgttgaagcatgcatgggagtcaatgttgcggttatggttggt 267
||||||| ||||| |||||||| || |||| || || || |||| || |||||||||
Sbjct: 994 gttgctacaactgacgttgttgaggcttgcactggggtaaacattgctgtcatggttggt 935
Query: 268 gggtttccacgaaaagaaggtatggagagaaaggatgtgatgtctaaaaatgtatctatt 327
|| || || | |||||||| ||||||||||| ||||||||||| |||||||| || ||
Sbjct: 934 ggcttccctaggaaagaaggaatggagagaaaagatgtgatgtcaaaaaatgtgtcaatc 875
Query: 328 tacaaggctcaggcttcagcattggagaagcatgctgctgcagattgcaag 378
|||||| | |||||||| || | ||||||||||| |||||| | ||||||
Sbjct: 874 tacaagtcccaggcttctgccctagagaagcatgcagctgcaaactgcaag 824