Jatropha Genome Database

JcCA0236591.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0236591.10 + phase: 2 /pseudo/partial
         (1269 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c10066                                                             68   6e-11

>KJC_c10066 
          Length = 687

 Score = 67.9 bits (34), Expect = 6e-11
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 767 cttactgggtatgatagagttatggtttacaagtttcatgaggatgaacatggtgaggtt 826
           |||||||| |||||||| |||||||| || ||||||||||| ||||| |||||||| |||
Sbjct: 41  cttactggctatgatagggttatggtgtataagtttcatgatgatgatcatggtgaagtt 100

             
Query: 827 gt 828
           ||
Sbjct: 101 gt 102



 Score = 63.9 bits (32), Expect = 9e-10
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1033 tggttgtcatgctcaatatatggcgaatatgggttcaattgcctcattggcaatggcggt 1092
            |||||| ||| |||| |||||||| ||||||||||||||||| |||||||  ||||| ||
Sbjct: 307  tggttgccatactcagtatatggctaatatgggttcaattgcttcattggtgatggcagt 366

                        
Query: 1093 cattattaatgg 1104
             ||||| |||||
Sbjct: 367  tattataaatgg 378