Jatropha Genome Database

JcCA0153141.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0153141.20 + phase: 0 
         (1047 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c02729                                                             64   7e-10

>KJC_c02729 
          Length = 985

 Score = 63.9 bits (32), Expect = 7e-10
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 712 gactacattcatgttatggacttggcagatggtcacattgctgc 755
           |||||||| |||||||| |||||||| |||||||||||||||||
Sbjct: 245 gactacatccatgttattgacttggcggatggtcacattgctgc 202



 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 238 aaatttgatgctgtaatccattttgctggcctaaaagcagttggggagag 287
           |||||||||||||| || || |||||||| |||||||||||||| |||||
Sbjct: 719 aaatttgatgctgtcatacactttgctgggctaaaagcagttggtgagag 670