Jatropha Genome Database

JcCA0150831.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0150831.20 + phase: 0 /pseudo/partial/short
         (146 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c02033                                                             82   4e-16

>KJC_c02033 
          Length = 522

 Score = 81.8 bits (41), Expect = 4e-16
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 20  ctgttgccaatgatattttccagtgcatgaatcacgggcgatccaccattgctggaaggt 79
           ||||||| |||||  ||||| | |||||||||  ||||||||||| | | ||||||||||
Sbjct: 442 ctgttgcaaatgaagttttcgattgcatgaattgcgggcgatccatcgtggctggaaggt 383

                                            
Query: 80  ttgccccttattcagaaaagtgcatgggaaagg 112
           |||| ||| ||| ||||||||||||||||||||
Sbjct: 382 ttgctcctcatttagaaaagtgcatgggaaagg 350