Jatropha Genome Database

JcCA0149861.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0149861.10 + phase: 0 
         (1455 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c07774                                                            131   5e-30
KJC_c00511                                                            131   5e-30

>KJC_c07774 
          Length = 373

 Score =  131 bits (66), Expect = 5e-30
 Identities = 84/90 (93%)
 Strand = Plus / Plus

                                                                       
Query: 54  aatcatatccactcaacggcctgtagccggagttccaaactgtatggagcgcagatctgc 113
           ||||||||||||||||| ||||||||| ||||| ||||||||||||| ||||||||||||
Sbjct: 148 aatcatatccactcaacagcctgtagctggagtaccaaactgtatggggcgcagatctgc 207

                                         
Query: 114 tattctatgtcgcgacatagccttatctac 143
           ||| |||||||||||||||| |||||||||
Sbjct: 208 tatcctatgtcgcgacatagtcttatctac 237


>KJC_c00511 
          Length = 1535

 Score =  131 bits (66), Expect = 5e-30
 Identities = 84/90 (93%)
 Strand = Plus / Minus

                                                                        
Query: 54   aatcatatccactcaacggcctgtagccggagttccaaactgtatggagcgcagatctgc 113
            ||||||||||||||||| ||||||||| ||||| ||||||||||||| ||||||||||||
Sbjct: 1325 aatcatatccactcaacagcctgtagctggagtaccaaactgtatggggcgcagatctgc 1266

                                          
Query: 114  tattctatgtcgcgacatagccttatctac 143
            ||| |||||||||||||||| |||||||||
Sbjct: 1265 tatcctatgtcgcgacatagtcttatctac 1236