Jatropha Genome Database

JcCA0131991.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0131991.10 - phase: 0 /partial
         (1060 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c04706                                                             52   3e-06

>KJC_c04706 
          Length = 738

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 548 tggctcatccggagaccgagtggatttggtgggttgactcagatgcagtgtttacagaca 607
           |||||||||||||| | |||||||| |||||||| || || |||||  |||| || ||||
Sbjct: 248 tggctcatccggaggcggagtggatctggtgggtggattccgatgccatgttcaccgaca 307

                     
Query: 608 tggagttcaa 617
           |||| |||||
Sbjct: 308 tggaattcaa 317