Jatropha Genome Database
- JcCA0122821.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0122821.10 - phase: 0
(890 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c00459 78 4e-14
>KJC_c00459
Length = 1191
Score = 77.8 bits (39), Expect = 4e-14
Identities = 99/119 (83%)
Strand = Plus / Plus
Query: 715 agaggagttagacaaaggcattggggcaaatgggttgcagaaattaggttaccaagaaac 774
|||||||| || ||||| ||||||||||| |||||||| |||||||| | || | ||||
Sbjct: 577 agaggagtaaggcaaagacattggggcaagtgggttgctgaaattagactccctaaaaac 636
Query: 775 agaactagggtttggttaggcacttttgaaacagcagaagaagctgctatggcttatga 833
||||| || | ||| | ||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 637 agaacaagactctggcttggcacttttgacacagccgaagaagctgccttggcttatga 695