Jatropha Genome Database

JcCA0122821.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0122821.10 - phase: 0 
         (890 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c00459                                                             78   4e-14

>KJC_c00459 
          Length = 1191

 Score = 77.8 bits (39), Expect = 4e-14
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 715 agaggagttagacaaaggcattggggcaaatgggttgcagaaattaggttaccaagaaac 774
           |||||||| || ||||| ||||||||||| |||||||| ||||||||  | || | ||||
Sbjct: 577 agaggagtaaggcaaagacattggggcaagtgggttgctgaaattagactccctaaaaac 636

                                                                      
Query: 775 agaactagggtttggttaggcacttttgaaacagcagaagaagctgctatggcttatga 833
           ||||| ||  | ||| | ||||||||||| ||||| |||||||||||  ||||||||||
Sbjct: 637 agaacaagactctggcttggcacttttgacacagccgaagaagctgccttggcttatga 695