Jatropha Genome Database
- JcCA0116831.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0116831.10 + phase: 0
(1515 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c02434 52 4e-06
>KJC_c02434
Length = 1108
Score = 52.0 bits (26), Expect = 4e-06
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 1055 taaaattagttattaaagaaactttgagattacatcct 1092
|||| ||| ||||||||||||| |||||||||||||||
Sbjct: 201 taaagttaattattaaagaaacattgagattacatcct 164