Jatropha Genome Database

JcCA0080571.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0080571.20 - phase: 0 
         (1035 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c07915                                                             98   5e-20

>KJC_c07915 
          Length = 329

 Score = 97.6 bits (49), Expect = 5e-20
 Identities = 94/109 (86%)
 Strand = Plus / Minus

                                                                       
Query: 776 atcgtgacttaatggttggatttgggaaatgggaatttgatccaatggatcttgaaaatc 835
           |||||||| | ||| |||||||||| | ||||||||||||||| ||||| || |||||||
Sbjct: 279 atcgtgacattatgattggatttggcacatgggaatttgatcctatggacctggaaaatc 220

                                                            
Query: 836 cttttcctaaaaatgaaggctcggttcatctatggcatggagatgaaga 884
           | ||||| || |||||||| || |||||||||||||| |||||| ||||
Sbjct: 219 catttccaaacaatgaaggttctgttcatctatggcaaggagatcaaga 171