Jatropha Genome Database

JcCA0080281.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0080281.10 - phase: 0 /pseudo
         (509 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c02456                                                            131   2e-30
KJC_c01072                                                            125   1e-28
KJC_c01045                                                            100   6e-21
KJC_s14223                                                             86   1e-16

>KJC_c02456 
          Length = 1198

 Score =  131 bits (66), Expect = 2e-30
 Identities = 192/234 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 cttgaagagaaaaaggaaagtaaaattctaaagttcttgggctttatgtggaatcctcta 219
           |||||||||||| |||| || ||| | || ||||| ||||| ||||||||||||||||| 
Sbjct: 123 cttgaagagaaacaggagagcaaattcctgaagtttttggggtttatgtggaatcctctt 182

                                                                       
Query: 220 tcatgggtcatggaagcagcagctatcatggccattgctcttgcacatggagggggcaag 279
           |||||||| |||||||| || ||||| ||||| |||||||||||| ||||||| || |||
Sbjct: 183 tcatgggtgatggaagctgctgctattatggctattgctcttgcaaatggaggagggaag 242

                                                                       
Query: 280 agtccagactatcatgattttgttggtatagtaatcttacttgtgatcaattccaccatc 339
             |||||| |  || || ||||| |||||  | |  || ||| ||||||| || || || 
Sbjct: 243 cctccagattggcaagactttgtgggtattattactttgcttttgatcaactctactatt 302

                                                                 
Query: 340 agtttcattgaggaaaacaatgctggcaatgcagctgctgcccttatggctcgg 393
           || || |||||||||||||||||||| ||||| |||||||| || |||||||||
Sbjct: 303 agctttattgaggaaaacaatgctggtaatgctgctgctgctctcatggctcgg 356


>KJC_c01072 
          Length = 1749

 Score =  125 bits (63), Expect = 1e-28
 Identities = 180/219 (82%)
 Strand = Plus / Plus

                                                                       
Query: 196 ttgggctttatgtggaatcctctatcatgggtcatggaagcagcagctatcatggccatt 255
           ||||| ||||||||||| ||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 168 ttgggttttatgtggaaccctctttcatgggtgatggaggcagcagctatcatggctatt 227

                                                                       
Query: 256 gctcttgcacatggagggggcaagagtccagactatcatgattttgttggtatagtaatc 315
           ||||||||  ||||||| || ||    || ||||  || ||||||||||| ||  | |  
Sbjct: 228 gctcttgctaatggaggaggaaaaccgcctgactggcaagattttgttggaattattact 287

                                                                       
Query: 316 ttacttgtgatcaattccaccatcagtttcattgaggaaaacaatgctggcaatgcagct 375
           || ||| | |||||||| || || ||||| || ||||| ||||||||||| ||||| |||
Sbjct: 288 ttgcttcttatcaattctactataagttttatagaggagaacaatgctggtaatgctgct 347

                                                  
Query: 376 gctgcccttatggctcggttggctcccaaagccaaggtc 414
           ||||| |||||||||||  | ||||||||||||||||||
Sbjct: 348 gctgctcttatggctcgtcttgctcccaaagccaaggtc 386


>KJC_c01045 
          Length = 3058

 Score = 99.6 bits (50), Expect = 6e-21
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                        
Query: 145  tttggacacaacaaacttgaagagaaaaaggaaagtaaaattctaaagttcttgggcttt 204
            |||||||  |||||| | |||||||||||||| || |||||||| ||||| |||||||||
Sbjct: 2763 tttggaccgaacaaattagaagagaaaaaggagagcaaaattctcaagtttttgggcttt 2704

                                                              
Query: 205  atgtggaatcctctatcatgggtcatggaagcagcagctatcatggccat 254
            |||||||||||  | ||||||||||||||||| || ||| | ||||||||
Sbjct: 2703 atgtggaatccattgtcatgggtcatggaagctgctgctctgatggccat 2654


>KJC_s14223 
          Length = 550

 Score = 85.7 bits (43), Expect = 1e-16
 Identities = 95/111 (85%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tttggacacaacaaacttgaagagaaaaaggaaagtaaaattctaaagttctt-gggctt 203
           |||||||  |||||| | |||||||||||||| || |||||||| ||||| || ||||||
Sbjct: 199 tttggaccgaacaaattagaagagaaaaaggagagcaaaattctcaagttttttgggctt 140

                                                              
Query: 204 tatgtggaatcctctatcatgggtcatggaagcagcagctatcatggccat 254
           ||||||||||||  | ||||||||||||||||| || ||| | ||||||||
Sbjct: 139 tatgtggaatccattgtcatgggtcatggaagctgctgctctgatggccat 89