Jatropha Genome Database

JcCA0079611.20
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0079611.20 + phase: 0 /partial
         (1176 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c01778                                                             60   1e-08

>KJC_c01778 
          Length = 698

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 769 ggagtaatgggatggtggccttcacgtgctgtaacatttttagagaaccatgatacagga 828
           ||||| |||||||||||||| || |||||||| || ||  ||||||| |||||||| || 
Sbjct: 449 ggagttatgggatggtggccatctcgtgctgttaccttcatagagaatcatgataccggt 508

                             
Query: 829 tcaacacagggtcactgg 846
           || || ||||||||||||
Sbjct: 509 tctactcagggtcactgg 526