Jatropha Genome Database
- JcCB0625131.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0625131.10 - phase: 0 /partial
(324 letters)
Database: JAT_13201ests
13,201 sequences; 6,040,684 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gi|268518207|gb|FM888481.1|FM888481 FM888481 Jatropha curcas emb... 64 1e-10
gi|237680502|gb|GO246714.1|GO246714 JcrME_RL0258 Expressed seque... 60 2e-09
>gi|268518207|gb|FM888481.1|FM888481 FM888481 Jatropha curcas embryo
35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_001906,
mRNA sequence
Length = 272
Score = 63.9 bits (32), Expect = 1e-10
Identities = 65/76 (85%)
Strand = Plus / Plus
Query: 136 cctggaatattattcggcatatctaatgttcaatttcctcttgcccgattgctatatcat 195
|||||||||| ||||||||| ||||||| || |||| ||||| | || |||||||||
Sbjct: 15 cctggaatatcattcggcatggctaatgtcgaacttccacttgcacacttactatatcat 74
Query: 196 tttgattggaaacttc 211
||||||||||||||||
Sbjct: 75 tttgattggaaacttc 90
>gi|237680502|gb|GO246714.1|GO246714 JcrME_RL0258 Expressed sequence
tags from Jatropha curcas root cDNA library Jatropha
curcas cDNA, mRNA sequence
Length = 700
Score = 60.0 bits (30), Expect = 2e-09
Identities = 30/30 (100%)
Strand = Plus / Plus
Query: 184 ttgctatatcattttgattggaaacttcct 213
||||||||||||||||||||||||||||||
Sbjct: 412 ttgctatatcattttgattggaaacttcct 441