Jatropha Genome Database
- JcCB0457001.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0457001.10 + phase: 0 /partial
(555 letters)
Database: JAT_13201ests
13,201 sequences; 6,040,684 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gi|268517581|gb|FM889292.1|FM889292 FM889292 Jatropha curcas emb... 109 3e-24
>gi|268517581|gb|FM889292.1|FM889292 FM889292 Jatropha curcas embryo
35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_002918,
mRNA sequence
Length = 600
Score = 109 bits (55), Expect = 3e-24
Identities = 55/55 (100%)
Strand = Plus / Plus
Query: 45 gatgggaatagcagatgctattttggatcttgtgagtagtggaacaacattgaaa 99
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 546 gatgggaatagcagatgctattttggatcttgtgagtagtggaacaacattgaaa 600