Jatropha Genome Database

JcCB0433081.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0433081.10 + phase: 0 
         (1371 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268525379|gb|FM896021.1|FM896021 FM896021 Jatropha curcas emb...    60   7e-09

>gi|268525379|gb|FM896021.1|FM896021 FM896021 Jatropha curcas embryo
            71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_003150,
            mRNA sequence
          Length = 560

 Score = 60.0 bits (30), Expect = 7e-09
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 1018 attggtgcattttggacacacagtggttggaattcgacattggagagtat 1067
            |||||||  |||| |||||||||||| ||||| |||||||||||||||||
Sbjct: 517  attggtgggtttttgacacacagtggatggaactcgacattggagagtat 468