Jatropha Genome Database

JcCB0138981.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0138981.10 + phase: 0 
         (954 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268521128|gb|FM891847.1|FM891847 FM891847 Jatropha curcas emb...    70   5e-12
gi|268521420|gb|FM894172.1|FM894172 FM894172 Jatropha curcas emb...    70   5e-12
gi|268525375|gb|FM896017.1|FM896017 FM896017 Jatropha curcas emb...    58   2e-08
gi|268517366|gb|FM887308.1|FM887308 FM887308 Jatropha curcas emb...    54   3e-07

>gi|268521128|gb|FM891847.1|FM891847 FM891847 Jatropha curcas embryo
           56-70 (DAF) Jatropha curcas cDNA clone rjcaeb0_002241,
           mRNA sequence
          Length = 282

 Score = 69.9 bits (35), Expect = 5e-12
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                       
Query: 783 tgttctcacttatgaagataaagaaggagattggatgcttgtcggagatgttccatgggg 842
           |||||| || ||||| |||||||| || |||||||||||||| || ||||||||||||| 
Sbjct: 40  tgttcttacatatgaggataaagatggtgattggatgcttgttggtgatgttccatggga 99

                  
Query: 843 gatgttc 849
           |||||||
Sbjct: 100 gatgttc 106


>gi|268521420|gb|FM894172.1|FM894172 FM894172 Jatropha curcas embryo
           71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_004362,
           mRNA sequence
          Length = 318

 Score = 69.9 bits (35), Expect = 5e-12
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 783 tgttctcacttatgaagataaagaaggagattggatgcttgtcggagatgttccatgggg 842
           |||||| || ||||| |||||||| || |||||||||||||| || ||||||||||||| 
Sbjct: 211 tgttcttacatatgaggataaagatggtgattggatgcttgttggtgatgttccatggga 152

                  
Query: 843 gatgttc 849
           |||||||
Sbjct: 151 gatgttc 145


>gi|268525375|gb|FM896017.1|FM896017 FM896017 Jatropha curcas embryo
           71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_003146,
           mRNA sequence
          Length = 569

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 793 tatgaagataaagaaggagattggatgcttgtcggagatgttccatgggggatgttc 849
           ||||| |||||||| |  |||||||||||||| || ||||||||||||| |||||||
Sbjct: 569 tatgaggataaagatgttgattggatgcttgttggtgatgttccatgggagatgttc 513


>gi|268517366|gb|FM887308.1|FM887308 FM887308 Jatropha curcas embryo
           35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_000478,
           mRNA sequence
          Length = 438

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 811 gattggatgcttgtcggagatgttccatgggggatgttc 849
           |||||||||||||| || ||||||||||||| |||||||
Sbjct: 299 gattggatgcttgttggtgatgttccatgggagatgttc 261