Jatropha Genome Database

JcCB0117661.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0117661.10 + phase: 2 /partial
         (985 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268516578|gb|FM887057.1|FM887057 FM887057 Jatropha curcas emb...    54   3e-07

>gi|268516578|gb|FM887057.1|FM887057 FM887057 Jatropha curcas embryo
           35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_000127,
           mRNA sequence
          Length = 472

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 710 gatgaatgcctcatcttagcgagtgatggtttgtgggatgtgatgacaaat 760
           ||||||||||| || ||||| ||||||||  |||||||||| |||||||||
Sbjct: 464 gatgaatgccttattttagccagtgatgggctgtgggatgtcatgacaaat 414