Jatropha Genome Database
- JcCB0097811.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0097811.10 + phase: 0 /partial
(426 letters)
Database: JAT_13201ests
13,201 sequences; 6,040,684 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gi|268525438|gb|FM896080.1|FM896080 FM896080 Jatropha curcas emb... 56 3e-08
>gi|268525438|gb|FM896080.1|FM896080 FM896080 Jatropha curcas embryo
71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_003223,
mRNA sequence
Length = 513
Score = 56.0 bits (28), Expect = 3e-08
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 218 atttaacaggaggttactatgatgctggtgataatgtaaaattt 261
||||||||||||| ||||| |||||||| ||||| |||||||||
Sbjct: 223 atttaacaggagggtactacgatgctggagataacgtaaaattt 266