Jatropha Genome Database

JcCB0096311.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0096311.30 - phase: 0 /pseudo/partial
         (765 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268525001|gb|FM895643.1|FM895643 FM895643 Jatropha curcas emb...    50   4e-06

>gi|268525001|gb|FM895643.1|FM895643 FM895643 Jatropha curcas embryo
           71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_002601,
           mRNA sequence
          Length = 552

 Score = 50.1 bits (25), Expect = 4e-06
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 313 aattactatcctccatgcccacaaccaga 341
           ||||||||||||||||| |||||||||||
Sbjct: 131 aattactatcctccatgtccacaaccaga 159