Jatropha Genome Database

JcCB0058681.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0058681.10 + phase: 0 
         (1104 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268518395|gb|FM888669.1|FM888669 FM888669 Jatropha curcas emb...    74   4e-13

>gi|268518395|gb|FM888669.1|FM888669 FM888669 Jatropha curcas embryo
           35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_002125,
           mRNA sequence
          Length = 551

 Score = 73.8 bits (37), Expect = 4e-13
 Identities = 103/125 (82%)
 Strand = Plus / Plus

                                                                       
Query: 196 tgtgaggtttgtgagcaagcacctgctgccgtcacttgcaaagccgacgctgccgctctt 255
           |||||||| || |||||||| || |||  |||||||||||| || |||||||| || || 
Sbjct: 82  tgtgaggtatgcgagcaagcgccggctcacgtcacttgcaacgctgacgctgcagccctc 141

                                                                       
Query: 256 tgtgtcacgtgcgatgatgatattcactccgctaacccactcgctcgccggcatgaacga 315
           ||||||||||||||   ||| || |||||||| || ||||| ||||| || || ||||||
Sbjct: 142 tgtgtcacgtgcgaccgtgacatccactccgcgaatccactggctcgacgacacgaacga 201

                
Query: 316 gttcc 320
           |||||
Sbjct: 202 gttcc 206