Jatropha Genome Database
- JcCB0019451.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0019451.10 + phase: 0
(567 letters)
Database: JAT_13201ests
13,201 sequences; 6,040,684 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gi|268520112|gb|FM889960.1|FM889960 FM889960 Jatropha curcas emb... 58 1e-08
>gi|268520112|gb|FM889960.1|FM889960 FM889960 Jatropha curcas embryo
35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_003722,
mRNA sequence
Length = 543
Score = 58.0 bits (29), Expect = 1e-08
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 379 attgctataaattgggctggtggattgcatcatgctaagaa 419
|||||| | |||||||||||||| |||||||||||||||||
Sbjct: 502 attgctttgaattgggctggtggtttgcatcatgctaagaa 542