Jatropha Genome Database

JcCB0012281.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0012281.10 - phase: 0 
         (1602 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268518176|gb|FM888450.1|FM888450 FM888450 Jatropha curcas emb...    50   8e-06

>gi|268518176|gb|FM888450.1|FM888450 FM888450 Jatropha curcas embryo
           35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_001869,
           mRNA sequence
          Length = 614

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 1   atggaaatggaaatggaaatggaag 25
           |||||||||||||||||||||||||
Sbjct: 500 atggaaatggaaatggaaatggaag 524