Jatropha Genome Database

JcCA0317081.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0317081.30 - phase: 0 
         (1008 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268518559|gb|FM888814.1|FM888814 FM888814 Jatropha curcas emb...    74   3e-13

>gi|268518559|gb|FM888814.1|FM888814 FM888814 Jatropha curcas embryo
           35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_002307,
           mRNA sequence
          Length = 510

 Score = 73.8 bits (37), Expect = 3e-13
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 542 caggtgctgacctcattgcatttgaaacagttccaaataaggttgaagctcaggcttatg 601
           |||| |||||| | ||||||||||| ||| |||| |||||| |||||||  |||| ||||
Sbjct: 256 caggagctgacataattgcatttgagacaattcctaataagcttgaagcaaaggcatatg 315

                                                                       
Query: 602 ctgacctattagaggaagaaaacataaaaatccctgcatggttctcctttaactctaagg 661
           |||| ||  | || |||||| |||||||||| || || |||||||| || || || ||||
Sbjct: 316 ctgagctgcttgaagaagaagacataaaaattccagcttggttctctttcaattccaagg 375

                                        
Query: 662 atggtatcaatgtggttagtggtgattct 690
           |||| || || || || ||||||||||||
Sbjct: 376 atggaattaacgtagtcagtggtgattct 404



 Score = 67.9 bits (34), Expect = 2e-11
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 422 ttggcagctatggagcttatttggctgatggatctgagtacagtgg 467
           ||||||||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 136 ttggcagctatggtgcttatttggctgatggttctgagtatagtgg 181