Jatropha Genome Database

JcCA0313091.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0313091.10 + phase: 0 
         (1527 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268518207|gb|FM888481.1|FM888481 FM888481 Jatropha curcas emb...    56   1e-07
gi|237680502|gb|GO246714.1|GO246714 JcrME_RL0258 Expressed seque...    52   2e-06

>gi|268518207|gb|FM888481.1|FM888481 FM888481 Jatropha curcas embryo
            35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_001906,
            mRNA sequence
          Length = 272

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1336 cctggaatattattcggcatatctaatgttcaatttcctcttgcccgattgctttatcat 1395
            |||||||||| |||||||||  |||||||  || |||| ||||| |  || || ||||||
Sbjct: 15   cctggaatatcattcggcatggctaatgtcgaacttccacttgcacacttactatatcat 74

                            
Query: 1396 tttgattggaaacttc 1411
            ||||||||||||||||
Sbjct: 75   tttgattggaaacttc 90


>gi|237680502|gb|GO246714.1|GO246714 JcrME_RL0258 Expressed sequence
            tags from Jatropha curcas root cDNA library Jatropha
            curcas cDNA, mRNA sequence
          Length = 700

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1384 ttgctttatcattttgattggaaacttcct 1413
            ||||| ||||||||||||||||||||||||
Sbjct: 412  ttgctatatcattttgattggaaacttcct 441