Jatropha Genome Database

JcCA0304601.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0304601.10 - phase: 0 
         (1473 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|237680502|gb|GO246714.1|GO246714 JcrME_RL0258 Expressed seque...    52   2e-06
gi|268518207|gb|FM888481.1|FM888481 FM888481 Jatropha curcas emb...    50   7e-06

>gi|237680502|gb|GO246714.1|GO246714 JcrME_RL0258 Expressed sequence
            tags from Jatropha curcas root cDNA library Jatropha
            curcas cDNA, mRNA sequence
          Length = 700

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1375 ttgctgtatcattttgattggaaacttcct 1404
            ||||| ||||||||||||||||||||||||
Sbjct: 412  ttgctatatcattttgattggaaacttcct 441


>gi|268518207|gb|FM888481.1|FM888481 FM888481 Jatropha curcas embryo
            35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_001906,
            mRNA sequence
          Length = 272

 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 74/89 (83%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                        
Query: 1315 agaagaatgtgt-ccaggaatattatttggcatatctaatgttcaatttccgcttgcccg 1373
            |||||||||||| || ||||||| ||| |||||  |||||||  || |||| ||||| | 
Sbjct: 2    agaagaatgtgtacctggaatatcattcggcatggctaatgtcgaacttccacttgcaca 61

                                         
Query: 1374 attgctgtatcattttgattggaaacttc 1402
             || || ||||||||||||||||||||||
Sbjct: 62   cttactatatcattttgattggaaacttc 90