Jatropha Genome Database

JcCA0293441.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0293441.10 - phase: 0 /pseudo/partial
         (210 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268524358|gb|FM895038.1|FM895038 FM895038 Jatropha curcas emb...    84   7e-17

>gi|268524358|gb|FM895038.1|FM895038 FM895038 Jatropha curcas embryo
           71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_001380,
           mRNA sequence
          Length = 547

 Score = 83.8 bits (42), Expect = 7e-17
 Identities = 42/42 (100%)
 Strand = Plus / Minus

                                                     
Query: 131 tgcagcaacacaacgaggtggaactgtctgcacttggaatgg 172
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 547 tgcagcaacacaacgaggtggaactgtctgcacttggaatgg 506