Jatropha Genome Database

JcCA0291961.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0291961.20 + phase: 0 /partial
         (1407 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|237680304|gb|GO246488.1|GO246488 JcrME_RL0032 Expressed seque...    50   7e-06

>gi|237680304|gb|GO246488.1|GO246488 JcrME_RL0032 Expressed sequence
            tags from Jatropha curcas root cDNA library Jatropha
            curcas cDNA, mRNA sequence
          Length = 413

 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 1360 cctgaggatagccatgttcttgcagcatatgctagtt 1396
            ||||| ||||||||||| | |||||||||||||||||
Sbjct: 249  cctgaagatagccatgtacatgcagcatatgctagtt 285