Jatropha Genome Database

JcCA0288061.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0288061.10 - phase: 0 
         (666 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268518068|gb|FM893443.1|FM893443 FM893443 Jatropha curcas emb...    66   5e-11

>gi|268518068|gb|FM893443.1|FM893443 FM893443 Jatropha curcas embryo
           56-70 (DAF) Jatropha curcas cDNA clone rjcaeb1_004231,
           mRNA sequence
          Length = 535

 Score = 65.9 bits (33), Expect = 5e-11
 Identities = 40/41 (97%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 554 ttttgagaaaggaggct-gtgaagaataatattgaattggt 593
           ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 535 ttttgagaaaggaggcttgtgaagaataatattgaattggt 495