Jatropha Genome Database

JcCA0282511.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0282511.10 + phase: 0 
         (1818 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268520393|gb|FM890241.1|FM890241 FM890241 Jatropha curcas emb...    62   2e-09

>gi|268520393|gb|FM890241.1|FM890241 FM890241 Jatropha curcas embryo
            35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_004057,
            mRNA sequence
          Length = 325

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                       
Query: 1762 attgaggtttgccattggatatttgagaatgatatgacttgga 1804
            |||||||| ||||| |||||||||||||||||| |||||||||
Sbjct: 270  attgaggtgtgccactggatatttgagaatgatttgacttgga 228