Jatropha Genome Database

JcCA0274811.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0274811.20 + phase: 1 /TE/partial
         (1115 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268518825|gb|FM889068.1|FM889068 FM889068 Jatropha curcas emb...    74   4e-13

>gi|268518825|gb|FM889068.1|FM889068 FM889068 Jatropha curcas embryo
           35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_002630,
           mRNA sequence
          Length = 509

 Score = 73.8 bits (37), Expect = 4e-13
 Identities = 82/97 (84%), Gaps = 5/97 (5%)
 Strand = Plus / Minus

                                                                       
Query: 22  atgatcagtctaaatggcgcaaattaccatatatggagaaataaaatgagagatctcctt 81
           ||||||| |||||||||||  ||||||||||||||||||||| | ||     ||||||||
Sbjct: 509 atgatcaatctaaatggcgggaattaccatatatggagaaattatat-----atctcctt 455

                                                
Query: 82  atggtaatcaaaatgcatctgccggtgtttggttcaa 118
           |||||| |||||||| || |||| |||||| ||||||
Sbjct: 454 atggtactcaaaatgtatttgcctgtgtttagttcaa 418