Jatropha Genome Database
- JcCA0270671.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0270671.10 - phase: 0
(1443 letters)
Database: JAT_13201ests
13,201 sequences; 6,040,684 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gi|268525778|gb|FM891033.1|FM891033 FM891033 Jatropha curcas emb... 86 1e-16
>gi|268525778|gb|FM891033.1|FM891033 FM891033 Jatropha curcas embryo
56-70 (DAF) Jatropha curcas cDNA clone rjcaeb0_001018,
mRNA sequence
Length = 231
Score = 85.7 bits (43), Expect = 1e-16
Identities = 73/83 (87%)
Strand = Plus / Minus
Query: 1361 agctgaggcaaattgggttcattgtttactccattggtaagccattagatgcatggttga 1420
|||||||| | ||||| |||||||| ||||| |||||||||||| | ||||||||| | |
Sbjct: 146 agctgagggagattggtttcattgtatactcaattggtaagccacttgatgcatggctca 87
Query: 1421 aggacatgcctgctgttgcttaa 1443
|||||||||||||||| ||||||
Sbjct: 86 aggacatgcctgctgtagcttaa 64