Jatropha Genome Database

JcCA0267751.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0267751.10 - phase: 0 
         (1509 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268518207|gb|FM888481.1|FM888481 FM888481 Jatropha curcas emb...    70   8e-12
gi|237680502|gb|GO246714.1|GO246714 JcrME_RL0258 Expressed seque...    50   7e-06

>gi|268518207|gb|FM888481.1|FM888481 FM888481 Jatropha curcas embryo
            35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_001906,
            mRNA sequence
          Length = 272

 Score = 69.9 bits (35), Expect = 8e-12
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                       
Query: 1345 cttccacttgcacagttactatatcattttgattggaagcttc 1387
            |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 48   cttccacttgcacacttactatatcattttgattggaaacttc 90


>gi|237680502|gb|GO246714.1|GO246714 JcrME_RL0258 Expressed sequence
            tags from Jatropha curcas root cDNA library Jatropha
            curcas cDNA, mRNA sequence
          Length = 700

 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 1363 ctatatcattttgattggaagcttcctggtggacagaagccagaagatcttga 1415
            |||||||||||||||||||| |||||||  ||  ||| |||||| ||||||||
Sbjct: 415  ctatatcattttgattggaaacttcctgacgggaagatgccagaggatcttga 467