Jatropha Genome Database

JcCA0246931.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0246931.10 - phase: 0 /partial
         (417 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268517582|gb|FM889293.1|FM889293 FM889293 Jatropha curcas emb...    64   1e-10

>gi|268517582|gb|FM889293.1|FM889293 FM889293 Jatropha curcas
          embryo 35-55 (DAF) Jatropha curcas cDNA clone
          rjcfea0_002919, mRNA sequence
          Length = 437

 Score = 63.9 bits (32), Expect = 1e-10
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                  
Query: 21 agcaattggaggatttgtgacgcattgtggatggaattca 60
          |||| |||||||||||||||| ||||||||||||||||||
Sbjct: 40 agcagttggaggatttgtgactcattgtggatggaattca 1