Jatropha Genome Database

JcCA0216321.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0216321.10 - phase: 0 
         (402 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|262091210|gb|GT228637.1|GT228637 JC202 Jatropha seeds from fr...    82   5e-16

>gi|262091210|gb|GT228637.1|GT228637 JC202 Jatropha seeds from
           fruits at three stages of maturation Jatropha curcas
           cDNA clone PL02SE.G02.scf 5', mRNA sequence
          Length = 540

 Score = 81.8 bits (41), Expect = 5e-16
 Identities = 41/41 (100%)
 Strand = Plus / Minus

                                                    
Query: 308 atattgaaccacttaaggtgtaccttgctaggtacagggag 348
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 540 atattgaaccacttaaggtgtaccttgctaggtacagggag 500