Jatropha Genome Database

JcCA0152991.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0152991.30 + phase: 0 /partial
         (962 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268523050|gb|FM896493.1|FM896493 FM896493 Jatropha curcas emb...    50   5e-06

>gi|268523050|gb|FM896493.1|FM896493 FM896493 Jatropha curcas embryo
           71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_003719,
           mRNA sequence
          Length = 626

 Score = 50.1 bits (25), Expect = 5e-06
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 568 tgcccttctttgagggctctttccttgtggaatttgccttctgttggcaatgaaggt 624
           ||||| || |||||||||||||| |||||| || | |||||||||||  ||||||||
Sbjct: 226 tgcccatcattgagggctctttctttgtgggatgtaccttctgttggtgatgaaggt 282