Jatropha Genome Database

JcCA0147021.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0147021.10 - phase: 0 /partial
         (588 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268524343|gb|FM895023.1|FM895023 FM895023 Jatropha curcas emb...    58   1e-08

>gi|268524343|gb|FM895023.1|FM895023 FM895023 Jatropha curcas embryo
           71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_001356,
           mRNA sequence
          Length = 445

 Score = 58.0 bits (29), Expect = 1e-08
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 547 aattatgatcctcctggtaattatattgg 575
           |||||||||||||||||||||||||||||
Sbjct: 290 aattatgatcctcctggtaattatattgg 262