Jatropha Genome Database
- JcCA0139601.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0139601.10 - phase: 0
(186 letters)
Database: JAT_13201ests
13,201 sequences; 6,040,684 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gi|262091321|gb|GT228748.1|GT228748 JC313 Jatropha seeds from fr... 56 1e-08
>gi|262091321|gb|GT228748.1|GT228748 JC313 Jatropha seeds from
fruits at three stages of maturation Jatropha curcas
cDNA clone PL06SE.E07.scf 5', mRNA sequence
Length = 603
Score = 56.0 bits (28), Expect = 1e-08
Identities = 70/84 (83%)
Strand = Plus / Plus
Query: 73 agaaatggactgttgaagaaagcttatgaattgtcagtcctttgcgatgctgaggttgcc 132
|||||||| |||||||||||||||| || | || || || ||||||||||| ||||||
Sbjct: 418 agaaatgggttgttgaagaaagcttacgagctttctgttctctgcgatgctgaagttgcc 477
Query: 133 ctcattgtcttctccagccgtggc 156
|| ||| ||||||| || ||||||
Sbjct: 478 cttattatcttctctagtcgtggc 501