Jatropha Genome Database

JcCA0079341.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0079341.20 - phase: 0 
         (1968 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268517598|gb|FM889309.1|FM889309 FM889309 Jatropha curcas emb...    52   2e-06

>gi|268517598|gb|FM889309.1|FM889309 FM889309 Jatropha curcas embryo
            35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_002940,
            mRNA sequence
          Length = 339

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 1360 actttggccgatgtttgcagagaaaa 1385
            ||||||||||||||||||||||||||
Sbjct: 261  actttggccgatgtttgcagagaaaa 286